Microsatellites scattered around genomes usually confer extrusion asymmetry on the region of DNA they occupy. Why this should occur is the subject of the following paper.
Microsatellites
that violate Chargaff’s second parity rule have base order-dependent
asymmetries in the folding energies of complementary DNA strands and may not
drive speciation
Journal of Theoretical Biology (2008) 254, 168-177
Copyright Elsevier Scientific
b The Clinical Experiment Center, the First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, China
c Department of Biochemistry, Queen's University,
2. Crick’s unpairing postulate
3. Chargaff’s second parity rule and folding symmetry
4. Calculation of folding energies
5. Symmetrical distribution of folding energies of top and bottom strands
6. Asymmetrical distribution of folding energies in telomeres
7. Asymmetrical distribution of folding energies in internal STR regions
8. Asymmetrical distribution is greater with short repeat units
9. Asymmetrical distribution when second parity rule is violated
|
Abstract Models for meiotic recombination based on Crick’s “unpairing postulate” require symmetrical extrusion of stem-loop structures from homologous DNA duplexes. The potential for such extrusion is abundant in many species and, for a given single-strand segment, can be quantitated as the “folding of natural sequence” (FONS) energy value. This, in turn, can be decomposed into base order-dependent and base composition-dependent components. The FONS values of top and bottom strands in most C. elegans segments are close, as are the corresponding base order-dependent and base composition-dependent components; any discrepancies are in the base composition-dependent component. This suggests that the strands would extrude with similar kinetics. However, interspersed among these segments and at the ends of chromosomes (telomeres) are segments containing short tandem repeats (microsatellites) which, by virtue of their high variability, have been postulated to inhibit the pairing of homologous chromosomes and hence drive speciation. In these segments there are usually wide discrepancies between the FONS values of top and bottom strands, mainly attributable to differences in base order-dependent components. Analyses of artificial microsatellites of different unit sizes and base compositions show that this asymmetrical distribution of folding potential is greatest for microsatellites when the units are short and violate Chargaff’s second parity rule. It is proposed that when there is folding asymmetry, recombination proceeds by special, strand-biased, somatic mechanisms analogous to those operating with Chi sequences in E. coli. If meiotic recombination in the germ-line requires extrusion symmetry, then a general inhibitory influence of microsatellite-containing segments could mask the antirecombinational influence of their variability. Thus, microsatellites may not have driven speciation. |
Keywords:
C. elegans; Chi sequences; Crick's
unpairing postulate; Microsatellites; Recombination; Short tandem repeats; Telomeres
Repetitive sequences form much of the genomes of organisms considered higher on the evolutionary scale and were postulated to play a role at the level of individual organisms (Britten and Davidson, 1971). However, the concept of “selfish DNA” led to the view that repetitive sequences might make “no specific contribution to the phenotype” (Orgel and Crick, 1980). Conceding this, it was argued that, since repetitive sequences tend to vary (a) more than unique sequences and (b) more between species than within a species, they “could act as a blunt instrument driving speciation by reproductive isolation alone, without reference to adaptation” (Robertson, 1981). Thus, repetitive sequences may be more important at the species, than at the individual, level. Sequence differences would impede the meiotic pairing of homologous chromosomes so impeding recombination and making interspecies hybrids infertile. Unable to continue the line through their hybrid, parents would be reproductively isolated from each other, and so would be deemed members of distinct species with the potential to pursue independent reproductive paths (Flavell, 1982). Consistent with this, it has been proposed that DNA sequence divergence (“chromosomal hypothesis”), rather than differences in gene function (“genic hypothesis”), underlies the majority of speciation events (Forsdyke, 2007a). We consider here whether divergence might be a general genomic property or might be driven by special non-genic sequences – namely, a class of highly variable repetitive sequence containing short tandem repeats (STRs) often referred to as “microsatellites” or “minisatellites” (Ellegren, 2004). |
2. Crick’s unpairing
postulate
|
Aggregations between molecules may be broadly classified as like-with-like and like-with-unlike. Like can aggregate with like by virtue of shared regularities in structure and/or resonance frequencies, as when pure crystals appear within a mixture of solutes in solution, or virus coat proteins aggregate (Lauffer, 1975; Muller, 1941). Like can aggregate with unlike by virtue of complementarity of structures and compatible resonance frequencies. Ostensibly, the pairing of homologous chromosomes in meiosis appears as an example of like-with-like aggregation. Yet, at the molecular level, Crowther (1922) drew an analogy with a sword pairing with its scabbard (i.e. complementarity of structure). Decades later the discovery of the double-helical structure of DNA revealed complementarity (A pairing with T, and G pairing with C) as a fundamental feature of this major chromosomal component (Watson and Crick, 1953). In his “unpairing postulate” Crick (1971) proposed that to initiate meiosis the strands in a DNA duplex would unpair thus allowing cross-pairing of strands without strand breakage (paranemic pairing). In other words, the “sword” of one duplex would pair with the matching “scabbard” of the other, and vice versa. If scabbards did not match (absence of homology) the pairing would fail, hence avoiding commitment to strand-breakage and launching a potential speciation event. Seeking broad generalizations, Crick considered the unpaired DNA strands as single-stranded bubbles. He did not explore the possibility that, by virtue of their palindrome content, the unpaired strands might rapidly adopt higher ordered stem-loop structures. In other words, the “swords” in single stranded sequences might find local “scabbards” within their own strands, thus perhaps militating against the cross-pairing between strands that he had postulated. Yet sequencing studies were already suggesting (since verified; e.g. (Forsdyke, 1995a) ) that the potential to assume local intra-strand stem-loop structures is abundant in nucleic acids of many species. Such structures usually contain sequences displaying a folding symmetry that can be described as “palindromic” since, at the duplex level, they read the same forward and backward. A duplex containing 5’AAAAAAAATTTTTTTT3’ is considered palindromic, whereas a duplex containing 5’AAAAAAAACCCCCCCC3’ is not (see below). A duplex with two complementary limbs separated by an intermediate region (e.g. 5’AAAAAAAAGGGGTTTTTTTT3’) would form a stem and a loop (in this case G-rich in the top strand) and would be considered to display partial palindromicity. In 1974 Crick wrote:
While intra-strand pairing between complementary sequences that had adopted stem-loop configurations seemed to contradict Crick’s model for inter-strand meiotic pairing, several more specific recombination models invoked intra-strand pairing, thus providing an adaptive explanation for the abundance of palindromes (Doyle, 1978; Sobell, 1972; Wagner and Radman, 1975). Consistent with the latter models, Tomizawa demonstrated for RNA that inter-strand pairing could follow exploratory “kissing” interactions between the loops in complementary single-strand molecules. Furthermore, Kleckner and Weiner (1993) suggested that the Tomizawa mechanism might apply to the pairing between stem loops extruded from the DNAs in homologous chromosomes (Zickler, 2006). Small differences in GC% (i.e. no violation of Chargaff’s second parity rule; see section 3) would suffice to disrupt pairing and impede recombination (Forsdyke, 2006; 2007a). There is a well-known association of recombination with palindromes (Leach, 1994), and a role for stem-loop intermediates has been suggested from studies of recombination in HIV and in its coreceptor gene (Zhang et al., 2005a; 2005b). Recent studies have shown that, despite the presence of heterologous duplexes, homologous DNA duplexes can aggregate in simple salt solution in the absence of proteins. However, whether stem-loop intermediates are involved is undetermined (Baldwin et al., 2008). A prediction of the stem-loop models is that complementary kissing interactions would be favored if the “sword” strands and “scabbard” strands of a DNA duplex were extruded with similar kinetics (Forsdyke, 2006; 2007a). As an indicator of this possibility, the “top” (“W”) strand of a duplex might show the same propensity to fold as its complementary “bottom” (“C”) strand. There would then be symmetry between the folding potential of top and bottom strands. We here report studies with the nematode worm C. elegans (supported by our unpublished studies with other organisms) that show this is generally true. However, the symmetry is often lost in microsatellite-containing regions, raising the possibility that, by virtue of the asymmetry, microsatellites might exert a general antirecombinational effect. Yet, microsatellites are thought to promote, not impede, recombination (Ellegren, 2004). We explore here the basis of this apparent paradox. |
3. Chargaff’s second parity rule and folding symmetry
|
For
the nuclear genomes of most biological species Chargaff’s first parity rule
for duplex DNA (A = T, G = C) also applies, to a close approximation, to single
stranded DNA (Chargaff’s second parity rule;
Forsdyke and Mortimer, 2000; Phillips
et al., 1987; Prabhu, 1993; Rogerson, 1989). Thus, the AT-rich DNA sequence 5’AAAAAAAATTTTTTTT3’ obeys Chargaff’s
second parity rule and has the potential to fold into a stem-loop (hairpin-like)
configuration
(Gierer, 1966). In an antiparallel duplex containing this sequence in its “top” (W) strand
(as listed in GenBank), the corresponding “bottom” (C) strand,
3’TTTTTTTTAAAAAAAA5’, has the same base composition and the same potential
to fold into a stem-loop configuration. Thus, there is symmetry in the folding
energies of top and bottom strands. Furthermore, the two strands would display
the same buoyant density when subjected to centrifugation in alkaline CsCl
gradients. In contrast, the AC-rich sequence 5’AAAAAAAACCCCCCCC3’ (top
strand) does not obey the second parity rule, has little potential to fold, and
has a different base composition from the corresponding GT-rich bottom strand,
3’TTTTTTTTTGGGGGGGG5’. However, since G can form a weak Watson-Crick
base-pair with T
(Allawi and SantaLucia, 1998), the latter sequence retains some potential to fold. Thus, there is asymmetry
in the folding energies of top and bottom strands. By virtue of their
composition differences, the two stands display different buoyant densities in
alkaline CsCl gradients. When banded in such gradients one strand can be
regarded as a “satellite” of the other. Indeed, a significant class of
repetitive sequences was discovered by virtue of this satellite property
(Flamm et al., 1969). Base composition and order both influence folding symmetry. Thus, the degrees
of symmetry/asymmetry would be modified if the orders of the bases were less
simple than shown above (e.g. if each sequence were shuffled). One
strand of many microsatellite sequences being GT-rich in violation of
Chargaff’s second parity rule, the corresponding duplexes would be expected to
display folding asymmetry and hence impede meiotic pairing (see Section 2). Yet,
paradoxically, GT-richness appears to favor
recombination. In prokaryotes recombination may be associated with “GT-rich
islands” (approx. 1 kb) that contain strand-specific “crossover hotspot
instigator” sequences – Chi sequences (GCTGGTGG;
E. coli) or Chi-like sequences (GNTGGTGG; H. influenzae; Bell et al., 1998; Lao and Forsdyke, 2000; Tracy et al., 1997). For their function Chi sequences require a GT-rich base composition, but the
order of bases is also important. Specific GT-rich sequences (GGGGCTGGG)
embedded in GT-rich regions are also important in the strand-biased
recombination events that allow immunoglobulin class switching in higher
eukaryotes. Here folding asymmetry would facilitate access of the mutagenic
deoxycytosine deaminase to the AC-rich strand
(Huang et al., 2007). The role of GT-richness in germ-line recombination is less clear
(Majewski and Ott, 2000; Wahls, 1998). Genetic studies that relate high linkage to low recombination between
polymorphic loci indicate that in recombination hot spots “there exist
multiple fuzzy DNA sequence determinants … based on the nature of the allele
present”
(Nishant and Rao, 2006). Our approach is less specific in that we study DNA, as DNA, irrespective of
the underlying function. |
For a given duplex DNA segment, the potential for a strand to be extruded to adopt a stem-loop structure can be quantitated as the "folding of natural sequence" (FONS) value of that structure. This, in turn, can be decomposed into a base order-dependent component (quantitated as the “folding of randomized sequence difference;” FORS-D) and a base composition-dependent component (quantitated as the “folding of randomized sequence mean;” FORS-M). These terms refer to methods of calculation from the energy values of computer-folded sequences (Mathews and Turner, 2006; Zuker, 2000). The average value of several independently shuffled versions of a sequence (base order having thus been eliminated) provides the base composition-dependent component. This value is subtracted from the corresponding value for the total folding energy (FONS) to obtain the base order-dependent component. Whatever the relative contributions of base order and composition, when the FONS values of top and bottom strands are close to zero, classical duplex forms would be expected to predominate in a DNA segment. High negative values would be expected to stabilize extruded stem-loops, a process that would be favoured by negative supercoiling (Forsdyke, 1995b; 1998; Wang et al., 1990). Misconceptions concerning the shuffling of sequences at the dinucleotide level, rather than at the level of single bases (mononucleotides), are discussed elsewhere (Forsdyke, 2007b; Xu et al., 2007). |
5. Symmetrical distribution of folding energies of top and bottom strands
|
Folding energy values were determined for 200 nt segments (“windows”) from the genome of C. elegans that were moved in steps of 50 nt along a sequence, using our program “Random_fold_scan,” with base order being randomized at the mononucleotide level by shuffling (Xu et al., 2007; Zhang et al., 2008). A representative result is shown in Figure 1. |
|
|
| Figure 1. The distribution of values for (a) FONS (total energy of folding), (b) FORS-D (the base order-dependent component), and (c) FORS-M (the base composition-dependent component), in the top strand (blue line) and bottom strand (red line) of a 40 kb segment of chromosome I of C. elegans (nucleotides 2500 to 42500). Folding energies were calculated for sequence windows (200 nt) that were moved in 50 nt steps. Sequences were retrieved from GenBank (accession numbers: chromosome I: NC_003279.5; chromosome II: NC_003280.6; chromosome III: NC_003281.7; chromosome IV: NC_003282.4; chromosome V: NC_003283.7; chromosome X: NC_003284.6). |
|
Total folding energy values fluctuated widely (Fig. 1a), and these fluctuations reflected changes in the base order-dependent component of the folding energy (Fig. 1b) more than the base composition-dependent component (Fig. 1c). The folding energies of top and bottom strands followed each other closely. However, there were small differences. Sometimes the top strand had the greatest folding potential (more negative FONS value), and sometimes the bottom strand had the greatest folding potential. The similarity between the two strands was also reflected in the values for FORS-D (Fig. 1b) and FORS-M (Fig. 1c). As described previously for various biological species, whereas FONS and FORS-M values were always negative, some FORS-D values were positive. Sometimes base order and base composition work together to generate the total folding energy (FONS) value and sometimes they work in opposition (Forsdyke, 1998; Xue and Forsdyke, 2003) . To
investigate other chromosomes, 600 windows (200 nt) were randomly selected from
each chromosome (software for this selection is available on request).
Table 1 shows that no significant overall differences were observed between the mean FORS-D values
of top and bottom strands of each chromosome. Whereas the autosomes (chromosomes
I to V)
had mean values around -4.32
kcal/mol, the X chromosome had a significantly lower
mean value (-2.35 kcal/mol; P<0.0001). Thus, on average, the X chromosome of C.
elegans displayed lower base order-dependent stem-loop potential than
autosomes. For each chromosome the average of the absolute differences between
individual paired FORS-D values of top and bottom strands was significantly
different from zero (Table 1; P<0.0001).
The average X chromosome absolute FORS-D
difference (1.74 kcal/mol) resembled that of chromosome I
(1.73 kcal/mol), but differed significantly from the other autosomes (average
difference 4.23 kcal/mol; P<0.0001). |
|
Folding
energies
(kcal/mol) |
Chromosome |
||||||
|
1 |
2 |
3 |
4 |
5 |
X |
||
|
FORS-D |
Top
strands (mean) |
-4.73 |
-3.97 |
-5.14 |
-4.23 |
-3.86 |
-2.29 |
|
Bottom
strands (mean) |
-4.70 |
-3.94 |
-4.88 |
-4.10 |
-3.68 |
-2.42 |
|
|
Probability
(P) a |
0.71 |
0.90 |
0.24 |
0.55 |
0.39 |
0.17 |
|
|
Absolute
differences (mean) b |
1.73±0.06
|
4.14±0.14
|
4.21±0.13
|
4.47±0.13
|
4.10±0.12
|
1.74±0.06
|
|
|
FORS-M |
Top strands (mean) |
-11.34 |
-22.73 |
-22.91 |
-22.43 |
-22.65 |
-11.12 |
|
Bottom strands (mean) |
-11.43 |
-22.98 |
-22.67 |
-22.41 |
-22.54 |
-11.13 |
|
|
Probability (P) a |
0.18 |
0.19 |
0.19 |
0.92 |
0.56 |
0.85 |
|
|
Absolute differences (mean) b |
1.21±0.04 |
3.77±0.11 |
3.68±0.11 |
3.51±0.11 |
3.72±0.11 |
1.04±0.03 |
|
a
The significance of differences between top and bottom strand means
(paired t-test).
b
Absolute differences between individual values for top and bottom strands.
Values are presented together with the standard error of the mean.
6.
Asymmetrical distribution of folding energies in telomeres
|
The symmetry of folding energies between the two strands was lost in telomeric regions which contain STRs (Cangiano and La Volpe, 1993). Figure 2 compares the two telomeric regions of chromosome I with a region randomly selected from the middle of the chromosome. In the telomeric regions the strands containing GT-rich repeats (bottom strand in Fig. 2a and top strand in Fig. 2c) had greater total folding energy (FONS) than the AC-rich complementary strands. This was due to differences in base order (Figs. 2d, f) more than in base composition (Figs. 2g, i). In contrast, relative symmetry was displayed by a short 144 nt segment in a telomeric region that was devoid of GT-rich STRs (Figs. 2a, d, g), and by the central non-telomeric region (Figs. 2b, e, h). Similar results were obtained with the telomeres of the other five C. elegans chromosomes (data not shown). |
|
|
| Figure
2. Telomeres display strand
asymmetry. Segments
(2.5 kb) from the 5' end (a, d, g), middle (b, e, h) and 3' end (c, f, i) of
chromosome I of C. elegans were folded as in Figure 1 to determine FONS
values (a, b, c), FORS-D values (d, e, f), and FORS-M values (g, h, i).
Telomeric boundaries are indicated by the vertical dashed line. For further
details please see text.
|
|
The symmetry of folding energies between the two strands was also lost in many internal regions containing STRs (with repeat unit sizes starting at 2 nt). A sample of these regions was obtained from chromosomes I and II using Tandem Repeats Finder (Benson, 1999). STR-containing segments were required to have individual repeats that (i) were short (less than 13nt), (ii) closely matched the other repeats in the segment (>90%), and (iii) had a collective length of at least 200nt. These were selected for fold analysis together with their flanking sequences. The results showed that some, but not all, of these internal STR sequences displayed the asymmetry in FONS (Figs. 3 a-f, h). A region on chromosome II (bases 6183938-6186538), which contained the 7nt-STR unit ACGCTAT that had a 100% match with its companion repeats and only slightly violated Chargaff’s second parity rule, did not display the asymmetry (Fig. 3g). Sometimes the top strand displayed the greatest folding propensity (more negative FONS value; Figs. 3 a, d, h), and sometimes the bottom strand (Figs. 3 b, c, e, f). Again, the asymmetries reflected differences in base order (FORS-D; Figs. 3i-p) more than in base composition (FORS-M; Figs. 3q-x). |
|
|
| Figure
3. Internal STR-containing sequences
display strand asymmetry. Fold analysis of some segments of C.
elegans chromosomes I and II that contain internal STR sequences. These
segments are from chromosome I: 748813-750313 (a, i, q), 2254662-2256162 (b, j,
r), 2254662-2256162 (c, k, s), 11655315-11656815 (h, p, x), and chromosome II:
2000479-2001279 (d, l, t), 2631644-2632644 (e, m, u), 3270800-3272300 (f, n, v),
6183938-6186538 (g, o, w), respectively. They were folded as in Figure 1
to determine FONS values (a-h), FORS-D values (i-p) and FORS-M values (q-x). |
8.
Asymmetrical distribution is greater with short repeat units
|
Rather
than continue with natural sequences, to identify general sequence
characteristics that might confer large differences in folding values between
top and bottom strands, we generated an artificial set of top strand STR-containing
sequences that varied in repeat unit length (5 -
50 nt), base composition, and base order. To avoid duplication in or between
different groups, these
STR sequences had to meet the following criteria: (i) Ability to fold using
RNAstructure 4.2 with local data files for DNA
(Mathews and Turner, 2006). (ii) Absence of internal tandem repeats. A repeat unit such as
5’ATGAATGA3’ would not qualify since it contains two shorter repeat units.
(iii) No cyclic permutability. For all possible tandem repeat sequences with the
same base order but different start nucleotides (e.g. 5’ GGACTAAT3’, 5’
GACTAATG3’, 5’ ACTAATGG3’ and 5’ CTAATGGA3’), only one can be
selected. (iv) No reverse complementarity. If two sequences are reverse
complementary (e.g. 5’ GGACTAAT 3’ and 5’ATTAGTCC 3’), only one can be
selected. A program (written with ActivePerl-5.8.8.820)
that can generate these sequences when given the size of repeat units and their
duplication number, is available on request. Previous studies having
shown the utility of 200nt windows sizes, here
we used the program to generate STRs of this size. A
200 nt sequence window might contain 20 copies of a 10 nt repeat unit, or 4
copies of a 50 nt repeat unit. For a given size of repeat unit a total of
600 STRs were generated randomly. For 5nt and 6nt repeat units only 58 and 220
sequences, respectively, satisfied the above criteria. STRs with smaller repeat
units were not generated. 600 top strand FORS-D values for such computer-generated STRs were hierarchically ordered and plotted with the corresponding bottom strand values (Fig. 4). In some cases the bottom strand values were more negative than top strand values. In other cases the bottom strand values were less negative than top strand values. Thus, while the top strand values gave smooth lines (because of the hierarchical ordering), bottom strand values gave irregular lines. These irregular fluctuations were greater in the case of STRs with shorter subunits (Fig. 4a), and were least in the controls (a set of natural sequences; Fig. 4c). Studies with other subunit sizes indicated progressively greater fluctuations as subunit size decreased (data not shown). The asymmetries were much less evident in the case of FORS-M values (Figs. 4d-f). |
|
|
| Figure
4. Variation of bottom strand
folding values (irregular red line) relative to top strand folding values
(regular blue line) for a series of 600 computer-generated STRs.
Top strand values for FORS-D
(a, b, c) and FORS-M (d, e, f) were hierarchically ordered from low negative to
high negative, and plotted with the corresponding bottom strand values. The 200
nt STR sequences in (a) and (d) have 20 x 10-nt repeats; those on (b) and (e)
have 4 x 50-nt repeats. The 600 natural
200 nt sequences, (c) and (f), were randomly selected from chromosome I of C.
elegans. |
|
The signs of the fluctuations were eliminated by taking absolute differences between top and bottom strand FORS-D values, which were again hierarchically ordered (Fig. 5). When compared with corresponding absolute FORS-M differences, that were relatively constant, absolute FORS-D differences of STR sequences exhibit larger values and great variation (Figs. 5a, b). |
|
|
| Figure 5. Variation of absolute FORS-M differences (irregular red line) relative to absolute FORS-D differences (regular blue line) for a series of computer-generated STRs. The values of absolute FORS-D differences were hierarchically ordered from low to high, and plotted with the corresponding values of absolute FORS-M differences. The STR sequences in (a) and (b) are 20 x 10-nt repeats and 4 x 50-nt repeats, respectively. The natural 200 nt sequences (c) are randomly selected from chromosome I of C. elegans. |
9.
Asymmetrical distribution when second parity rule is violated
|
For
600 computer-generated 10 nt repeat unit STRs, the influence of top strand base
composition (e.g. [G + C]% written as GC%) on the difference between top and
bottom strand FORS-D and FORS-M values was investigated by first order linear
regression. Differences in GC% (i.e. Chargaff’s second parity rule was not
violated) affected the differences between the strands neither of the STR-containing
sequences (Figs. 6a, 7a), nor of the control series of 600 natural 200 nt
sequences (Figs. 6d, 7d). Thus, there were no differences in FONS values (the
sum of FORS-D and FORS-M values). Stem-loop extrusion from duplexes would be
symmetrical both at low and high GC% values. However,
differences in AG% (that would reciprocally correspond to bottom strand CT%),
and especially differences in GT% (that would reciprocally correspond to bottom
strand AC%), were correlated with large differences between both the FORS-D
values and FORS-M values in the case of the computer-generated STR-containing
sequences (Figs. 6b,c; Figs. 7b,c). Thus, this group of sequences included
sequences that, by virtue both of their base composition and order, would have
differed widely in the FONS values of their complementary strands. Stem-loop
extrusion from such duplexes would have been increasingly asymmetrical as their
A+G or G+T content increased. In
the case of the natural sequences, differences in AG% and GT% either did not
correlate with differences in strand FORS-D values (Fig. 6e), or correlated very
weakly (Fig. 6f). On the other hand, differences in AG%, and especially
differences in GT%, correlated well with differences in strand FORS-M values
(Figs. 7e, f). Thus, total folding energy values (FONS) would differ between top
and bottom strands as the A+G or G+T content of the top strand of a segment
increased, but this would mainly reflect differences in base composition.
The particular computer-generated sequences which, by virtue of their base orders,
accounted for the differences between FORS-D values (Figs. 6b,c) would either
not have been present, or would have been present at very low frequencies, in
the natural sequences (Figs. 6e,f). Thus, for natural sequences it is usually
differences in base composition alone (AG% or GT%), that correlate with
asymmetrical folding of top and bottom strands. Differences in GC% do not
violate the second parity rule so folding is symmetrical. |
|
|
| Figure
6. Dependence of FORS-D
differences between top and bottom strands on base compositions. The 600 FORS-D
differences for computer-generated 200nt sequences containing tandem 10nt repeat
units were plotted against the corresponding values for (a) GC%, (b) AG% and (c)
GT%. The 600 FORS-D differences for randomly selected natural 200nt sequences
from chromosome I were plotted similarly (d, e, f). Base compositions refer to
the top strand of each DNA sequence. FORS-D differences were calculated by
substracting bottom strand values from the corresponding top strand values.
Parameters of the least-squares regression lines are slope (S), the coefficient
of determination (r2),
and the probability (P value) that the slope of the line is not significantly
different from zero. Statistical analyses were conducted with GraphPad
Prism version 4.03 for Microsoft Windows. |
|
|
| Figure
7. Dependence of FORS-M differences between top and bottom strands on base
compositions. For details see Figure 6. |
|
For most sequence segments violations of Chargaff’s second parity rule are minimal, and the strands of a duplex have the potential to adopt single-strand stem-loop configurations in a symmetrical manner (Fig. 1; Table 1). In this circumstance, recombination could be in accord with models for germ-line meiotic strand pairing based on Crick’s unpairing postulate. The major disruptor of the pairing between two independent duplexes would be differences in GC% between the two duplexes, the individual strands of each duplex being extruded symmetrically by virtue of their common GC% (Forsdyke, 2006; 2007a). Where symmetry failed it would be due to strand differences in certain bases (i.e. AG% and/or GT%), irrespective of their order (Figs. 6, 7). Thus, distinct sequences would not be involved. However, the symmetry would fail in telomeric regions (Fig. 2) and in other regions containing STRs (Fig. 3), due to both the composition and the order of bases (Figs. 6, 7). Distinct sequences would be involved. The failure would be greatest when the STRs were small and violations of Chargaff’s second parity rule were maximal (Figs. 4, 5; Table 2). |
Table
2. Linear regression analysis of FORS-D differences between top and bottom
strands versus base composition of STRs
|
Base
composition a |
Repeat
units contained in 200 nt STRs
b |
|||||||||
|
5nt |
6nt |
7nt |
10
nt |
13
nt |
20
nt |
30
nt |
40
nt |
50
nt |
||
|
GC% |
S |
0.0726 |
-0.0013 |
0.0018 |
0.0354 |
-0.0233 |
0.0703 |
-0.0019 |
0.0072 |
0.0483 |
|
r2 |
0.0031 |
0.0000 |
0.0000 |
0.0011 |
0.0005 |
0.0063 |
0.0000 |
0.0001 |
0.0036 |
|
|
P |
0.6970 |
0.9875 |
0.9677 |
0.4494 |
0.5860 |
0.0572 |
0.9561 |
0.8135 |
0.1429 |
|
|
AG% |
S |
-0.5945 |
-0.5485 |
-0.2338 |
-0.2079 |
-0.2065 |
-0.0885 |
-0.0832 |
-0.0566 |
0.0076 |
|
r2 |
0.0607 |
0.1097 |
0.0367 |
0.0281 |
0.0388 |
0.0095 |
0.0096 |
0.0060 |
0.0001 |
|
|
P |
0.0813 |
<
0.0001 |
<
0.0001 |
0.0001 |
<
0.0001 |
0.0193 |
0.0175 |
0.0584 |
0.8094 |
|
|
GT% |
S |
-1.0890 |
-0.5868 |
-0.4742 |
-0.5215 |
-0.4139 |
-0.1989 |
-0.2039 |
-0.0884 |
-0.0945 |
|
r2 |
0.4250 |
0.2117 |
0.1807 |
0.1748 |
0.1393 |
0.0477 |
0.0587 |
0.0134 |
0.0151 |
|
|
P |
<
0.0001 |
<
0.0001 |
<
0.0001 |
<
0.0001 |
<
0.0001 |
<
0.0001 |
<
0.0001 |
0.0047 |
0.0026 |
|
a
S, slope;
r2, the
coefficient of determination; P, the probability that the slope of the
least-squares line is not significantly different from zero.
b For 5nt and 6nt repeat unit sizes, only 58 and 220 sequences
could be generated by our program.
|
In view of the highly specialized nature of telomeres (Verdun and Karlseder, 2007) and the fact that asymmetry between top and bottom strands can be associated with specialized forms of recombination (Huang et al., 2007), it seems likely that telomeric and interspersed regions containing STRs (Figs. 2, 3) are, in some way, specialized for functions involving somatic recombination, and contain distinct sequences adapted for this. In such regions recombination would be highly regulated, requiring specialized proteins analogous to some of those mediating recombination in the GT-rich islands containing Chi sequences in E. coli. For
example, the telomeric DNA of eukaryotes such as C.
elegans has a single-stranded GT-rich 3’ extension that would only weakly
bond with itself. As such, under the influence of a variety of specialized
proteins
(Raices et al., 2008)
it might readily invade a neighboring duplex with its identical strand being
displaced as a “D-loop.” The resulting “T-loop” might decrease telomere
erosion. Alternatively, the single stranded form might more readily engage in a
recombination-dependent form of telomere regeneration known as ALT
(“alternative lengthening of telomeres”;
Verdun and Karlseder, 2007). It should be noted that, depending on salt concentration, G-rich regions have
the potential (i) to aggregate
(Forsdyke, 1984)
with the formation of G-quartets
(Henderson et al., 1987; Williamson et al., 1989)
, and (ii) to form Z-DNA
(Haniford and Pulleyblank, 1983). The folding programs we have employed
(Mathews and Turner, 2006; Zuker, 2000)
do not take such possibilities into account. Apart from a somatic role, their association with meiotic recombination hotspots suggests a role for STRs in the germ line. That the association is indicative of a role in the termination, rather than initiation, of meiotic recombination has been suggested by Wahls (1998); some characteristic of satellites is held to arrest the branch migration that may follow formation of Holliday junctions. Thus, recombination could initiate in a flanking non-satellite region and terminate within the satellite due to some inhibitory influence. Perhaps the enzymes involved would sense the potential extrusion asymmetry. In
summary, extrusions of higher ordered structures from DNA duplexes vary between
the extremes of close symmetry and highly asymmetry. We have argued that a
germ-line event (the initiation of divergence into distinct species) is likely
to be influenced by meiotic recombination when there is symmetry of strand
extrusion from DNA duplexes (i.e. Chargaff’s second parity rule applies). If
this is true then, by virtue of their extrusion asymmetry, regions adapted for
special forms of somatic recombination might be less favorably adapted for the
strand pairing that initiates meiotic recombination (for an alternative view see
Rockmill and Roeder, 1998). High variability (associated with microsatellite content) might then fail to
register in terms of the increased pairing incompatability between homologous
chromosomes that is expected to precede speciation. In this circumstance, and
without excluding roles for other classes of repeat sequence, a role for
microsatellites as drivers of speciation is in doubt. |
Acknowledgements
This
work was supported by research grants from National Natural Science Foundation
of China (No. 30600352) and Natural Science Foundation of Jiangsu Province,
China (No. BK2006550), and the Startup Fund from
Allawi, H.T., and SantaLucia, J., Jr., 1998. NMR
solution structure of a DNA dodecamer containing single G.T mismatches. Nucleic
Acids Res. 26, 4925-4934.
Baldwin,
G.S., Brooks, N.J., Robson, R.E., Wynveen, A., Goldar, A., Leikin, S., Seddon,
J.M., and Kornyshev, A.A., 2008. DNA Double Helices Recognize Mutual Sequence
Homology in a Protein Free Environment. J. Phys. Chem. B 112, 1060-1064.
Bell,
S.J., Chow, Y.C., Ho, J.Y., and Forsdyke, D.R., 1998. Correlation of chi
orientation with transcription indicates a fundamental relationship between
recombination and transcription. Gene 216, 285-292.
Benson,
G., 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic
Acids Res. 27, 573-580.
Britten,
R.J., and Davidson, E.H., 1971. Repetitive and non-repetitive DNA sequences and
a speculation on the origins of evolutionary novelty. Quart. Rev. Biol. 46,
111-138.
Cangiano,
G., and La Volpe, A., 1993. Repetitive DNA sequences located in the terminal
portion of the Caenorhabditis elegans chromosomes.
Nucleic Acids Res. 21, 1133-1139.
Crick,
F., 1971. General model for the chromosomes of higher organisms. Nature 234,
25-27.
Crick,
F., 1974. Letter from F. Crick to G. Khorana 28th June 1974. National Library of
Medicine, Washington. http://profiles.nlm.nih.gov/SC/B/B/M/Q/_/scbbmq.pdf.
Crowther,
C.R., 1922. Evolutionary faith and modern doubts. Nature 109, 777.
Doyle,
G.G., 1978. A general theory of chromosome pairing based on the palindromic DNA
model of Sobell with modifications and amplifications. J. Theor. Biol. 70,
171-184.
Ellegren,
H., 2004. Microsatellites: simple sequences with complex evolution. Nat. Rev.
Genet. 5, 435-445.
Flamm,
W.G., Walker, P.M., and McCallum, M., 1969. Some properties of the single
strands isolated from the DNA of the nuclear satellite of the mouse (Mus
musculus). J. Mol. Biol. 40, 423-443.
Flavell,
R.B., Sequence amplification, deletion and rearrangement: major sources of
variation during species divergence, in: Dover, G. A., Flavell, R.B. , (Ed.),
Genome Evolution, Academic Press,
San Diego 1982, pp. 301-323.
Forsdyke,
D.R., 1984. Purification of oligo dG-tailed Okayama-Berg linker DNA fragments by
oligo dC-cellulose chromatography. Anal. Biochem. 137, 143-145.
Forsdyke,
D.R., 1995a. Relative roles of primary sequence and (G + C)% in determining the
hierarchy of frequencies of complementary trinucleotide pairs in DNAs of
different species. J. Mol. Evol. 41, 573-581.
Forsdyke,
D.R., 1995b. Reciprocal relationship between stem-loop potential and
substitution density in retroviral quasispecies under positive Darwinian
selection. J. Mol. Evol. 41, 1022-1037.
Forsdyke,
D.R., 1998. An alternative way of thinking about stem-loops in DNA. A case study
of the human G0S2 gene. J. Theor. Biol. 192, 489-504.
Forsdyke,
D.R., 2006. Evolutionary Bioinformatics. Springer, New York.
Forsdyke,
D.R., 2007a. Molecular sex: the importance of base composition rather than
homology when nucleic acids hybridize. J. Theor. Biol. 249, 325-330.
Forsdyke,
D.R., 2007b. Calculation of folding energies of single-stranded nucleic acid
sequences: Conceptual issues. J. Theor. Biol. 248, 745-753.
Forsdyke,
D.R., and Mortimer, J.R., 2000. Chargaff's legacy. Gene 261, 127-137.
Gierer,
A., 1966. Model for DNA and protein interactions and the function of the
operator. Nature 212, 1480-1481.
Haniford,
D.B., and Pulleyblank, D.E., 1983. Facile transition of poly[d(TG) x d(CA)] into
a left-handed helix in physiological conditions. Nature 302, 632-634.
Henderson,
E., Hardin, C.C., Walk, S.K., Tinoco, I., Jr., and Blackburn, E.H., 1987.
Telomeric DNA oligonucleotides form novel intramolecular structures containing
guanine-guanine base pairs. Cell 51, 899-908.
Huang,
F.T., Yu, K., Balter, B.B., Selsing, E., Oruc, Z., Khamlichi, A.A., Hsieh, C.L.,
and Lieber, M.R., 2007. Sequence dependence of chromosomal R-loops at the
immunoglobulin heavy-chain Smu class switch region. Mol. Cell. Biol. 27,
5921-5932.
Kleckner,
N., and Weiner, B.M., 1993. Potential advantages of unstable interactions for
pairing of chromosomes in meiotic, somatic, and premeiotic cells. Cold Spring
Harb. Symp. Quant. Biol. 58, 553-565.
Lao,
P.J., and Forsdyke, D.R., 2000. Crossover hot-spot instigator (Chi) sequences in
Escherichia coli occupy distinct recombination/transcription islands. Gene 243,
47-57.
Lauffer,
M.A., 1975. Entropy-Driven Processes in Biology. Springer-Verlag, New York.
Leach,
D.R., 1994. Long DNA palindromes, cruciform structures, genetic instability and
secondary structure repair. Bioessays 16, 893-900.
Majewski,
J., and Ott, J., 2000. GT repeats are associated with recombination on human
chromosome 22. Genome Res. 10, 1108-1114.
Mathews,
D.H., and Turner, D.H., 2006. Prediction of RNA secondary structure by free
energy minimization. Curr. Opin. Struct. Biol. 16, 270-278.
Muller,
H.J., 1941. Resumé and perspectives of the symposium on genes and chromosomes.
Cold Spring Harb. Symp. Quant. Biol. 9, 290-308.
Nishant,
K.T., and Rao, M.R., 2006. Molecular features of meiotic recombination hot
spots. Bioessays 28, 45-56.
Orgel,
L.E., and Crick, F.H., 1980. Selfish DNA: the ultimate parasite. Nature 284,
604-607.
Phillips,
G.J., Arnold, J., and Ivarie, R., 1987. Mono- through hexanucleotide composition
of the Escherichia coli genome: a
Markov chain analysis. Nucleic Acids Res. 15, 2611-2626.
Prabhu,
V.V., 1993. Symmetry observations in long nucleotide sequences. Nucleic Acids
Res. 21, 2797-2800.
Raices,
M., Verdun, R.E., Compton, S.A., Haggblom, C.I., Griffith, J.D., Dillin, A., and
Karlseder, J., 2008. C. elegans telomeres contain G-strand and C-strand
overhangs that are bound by distinct proteins. Cell 132, 745-757.
Robertson,
M., 1981. Gene families, hopeful monsters and the selfish genetics of dna.
Nature 293, 333-334.
Rockmill,
B., and Roeder, G.S., 1998. Telomere-mediated chromosome pairing during meiosis
in budding yeast. Genes Dev. 12, 2574-2586.
Rogerson,
A.C., 1989. The sequence asymmetry of the Escherichia
coli chromosome appears to be independent of strand or function and may be
evolutionarily conserved. Nucleic Acids Res. 17, 5547-5563.
Sobell,
H.M., 1972. Molecular mechanism for genetic recombination. Proc. Natl. Acad. Sci.
USA 69, 2483-2487.
Tracy,
R.B., Chedin, F., and Kowalczykowski, S.C., 1997. The recombination hot spot chi
is embedded within islands of preferred DNA pairing sequences in the E. coli
genome. Cell 90, 205-206.
Verdun,
R.E., and Karlseder, J., 2007. Replication and protection of telomeres. Nature
447, 924-931.
Wagner,
R.E., Jr., and Radman, M., 1975. A mechanism for initiation of genetic
recombination. Proc. Natl. Acad. Sci. USA 72, 3619-3622.
Wahls,
W.P., 1998. Meiotic recombination hotspots: shaping the genome and insights into
hypervariable minisatellite DNA change. Curr. Top. Dev. Biol. 37, 37-75.
Wang,
J.C., Caron, P.R., and Kim, R.A., 1990. The role of DNA topoisomerases in
recombination and genome stability: a double-edged sword? Cell 62, 403-406.
Watson,
J.D., and Crick, F.H., 1953. Genetical implications of the structure of
deoxyribonucleic acid. Nature 171, 964-967.
Williamson,
J.R., Raghuraman, M.K., and Cech, T.R., 1989. Monovalent cation-induced
structure of telomeric DNA: the G-quartet model. Cell 59, 871-880.
Xu,
S.G., Wei, J.F., and Zhang, C.Y., 2007. A FORS-D analysis software
“Random_fold_scan” and the influence of different shuffle approaches on FORS-D
analysis [in Chinese]. J. Jiangsu Univ.(Med. Edition) 17, 461-466,470.
Xue,
H.Y., and Forsdyke, D.R., 2003. Low-complexity segments in Plasmodium falciparum
proteins are primarily nucleic acid level adaptations. Mol. Biochem. Parasitol.
128, 21-32.
Zhang,
C.Y., Wei, J.F., and He, S.H., 2005a. The key role for local base order in the
generation of multiple forms of China HIV-1 B'/C intersubtype recombinants. BMC
Evol. Biol. 5, 53.
Zhang,
C.Y., Wei, J.F., and He, S.H., 2005b. Local base order influences the origin of
ccr5 deletions mediated by DNA slip replication. Biochem. Genet. 43, 229-237.
Zhang,
C.Y., Wei, J.F., Wu, J.S., Xu, W.R., Sun, X., and He, S.H., 2008. Evaluation of
FORS-D Analysis: A Comparison with the Statistically Significant Stem-loop
Potential. Biochem. Genet. 46, 29-40.
Zickler,
D., 2006. From early homologue recognition to synaptonemal complex formation.
Chromosoma 115, 158-174.
Zuker,
M., 2000. Calculating nucleic acid secondary structure. Curr. Opin. Struct.
Biol. 10, 303-310.
![]()
Bioinformatics Index (Click Here)
HomePage (Click Here)
![]()
This page was established in May 2008 and was last edited on 14 Aug 2008 by D. Forsdyke