E. coli recombination cloning

This is like Gibson Asembly without using any of the enzymes. Just mix vector and insert with homology arms and transform into E. coli.

Use 150ng of vector (eg. pBSII SK+ cut at EcoRV or use PCR to derive a linear vector see below)

For insert use 2:1 insert to vector concentration, use online ligation calculator LIGATION CALCULATOR 

nanodrop both insert and vector to find out how many ul to use. (Note: The nanodrop to be questionable at times, sometimes I find that the concentration reading is very low but running a sample on a gel shows a bright band, so in these cases I just estimate the concentration compared to the ladder)

Use a 10ul reaction (once purified, you usually end up using 1-3ul insert and 1-3ul vector and make the rest up with water).

Leave at room temp for 5 mins

Ice 10 mins

Put 3ul into  frozen competent cells of choice (usually Top10), let sit for 30 mins

Heatshock 30s in 42C waterbath

Ice 10 mins

Add 950ul of 2XTY without antibiotics, put on shaker in 37C room

Plate cells on agar plates with selection antibiotics.


Primers with pBSII compatible ends to clone at the EcoRV site of pBSII SK+

Forward primer:  5’ acggtatcgataagcttgatxxxxxx(target seq)xxxx

Reverse primer 5’ ccgggctgcaggaattcgatxxxxxx(target seq)xxxx

Use the above primers to clone whatever you want cloned into pBSII SK+

 Primers to PCR pBSII backbone at the EcoRV site:

oIC1607: 5’ atcgaattcctgcagcccgggg

oIC1608: 5’ atcaagcttatcgataccgtcgacctc

Use these primers with pBSII SK+ as template (2.9kb) and treat PCR product with DpnI prior to using in cloning step.

The protocol is based on:

We have tried this protocol and it works really well. E. coli will take linearized vector and insert with 20bp homology overlaps  (like Gibson assembly but without enzyme mix) and recombine the two pieces into a circular plasmid. We have tried with DH5 alpha, Top10 and XL1Blue.  We treat with  T4 DNA polymerase (3’ Exonuclease activity)  for 2.5 minutes  and this increases the efficiency.  See this SLIC paper and protocol.  Here is another paper that uses 40-50bp homolgy overlap and can recombine multiple fragments. And another one calle AQUA cloning. They also use this method for insertions, deletions, or substitutions. The method shows a broad compatibility with most widely used lab-strains of E. coli, including TOP10, NEB5α, NEB10β, BL21 (DE3) and JM109.